US teen clocks up 14,528 text messages Greg Hardesty of the Orange County Register has described himself as "speechless" after his 13-year-old daughter "racked up 14,528 text messages in one month", as the shaken dad himself put it last week. Hardesty, 45, explains that offspring Reina achieved the impressive SMS tally between 27 November and 26 December. Her 22- …
She'll be arthritic by 16.
Assuming that she never eats, sleeps or bathes, that's one every 2.9 minutes. Does the AT&T contract have a fair usage clause?
More realistically, assuming that she's like most other teenage girls and spends 75% of the time either asleep or in the shower, that's one every 44 seconds.
Paris because that question mark is what her fingers will look like soon.
Assuming that for every text she sent she got a reply, and taking into account she receives FW:FW:FW:FW:FW:FW: LOL texts, lets take her down to 7000 outgoing texts.
Which works out at 233 per day. (14 per waking hour (16))
Is that really a newsworthy number? December, school holidays, she was probably using her phone like an IM client....could easily fire through 50 in a couple of bored hours..
If I understand my plan correctly, AT&T charges for every message *delivered*. So, if you're sending broadcast messages to a 25 person list (e.g. if you're one of the 'social organizers' in your clique), you can hit the 400/month limit pretty darn quickly ... Yeah, with teens, "unlimited" is definately the right option for any wireless plan. (I think they have too much time on their hands.)
14000 a month, divide that by 2 as they are charged for incoming texts.
So thats 7k texts sent potentially - in response to texts sent.
Divide that my 30 days in an average month... 233.333... (lets call it 233)
Divide that by the average time awake (16hours) equals 14.5625.
One text every 14.5625 minutes sent... that's kinda doable if your having text sex or a horny teenager.
Paris, cos she bangs horny teenagers (but only slept with 2 people).
And that was in one direction
OK, I admit it was an automated text sending a status/GPS location every 5 minutes, and I was asked to stop as it's against my "fair use" policy on my supposed "unlimited" contract.
My daughter gets pretty close to her unlimited ("fair use, read 3000") contract most months.
"Text-messaging is now hard-wired into our culture. It's in our DNA."
At last. An explanation for all those text messages I keep receiving that say "CAGGTTACGTACGATTACGGGCTCA"
I've registered the gene at the patent office, and called it "Txt2u"
Mine's the white one with the pens in the breast pocket.
I have a friend who writes very long (hilarious) text messages. Sometimes they are 8 messages long, and they crease me up. He sends these to about 20 people at a time. Now you can see where that huge number comes from, as that's 160 messages used in the couple of minutes it took him to write it.
If that was 14,000 *unique* messages then that would be frankly astonished.
Agree - if you give a teenager a recent nokia or anything else that can send an SMS to a list in a couple of clicks you will end up with 5K plus messages in a jiffie.
This is US as well. Don't they also charge you for receiving messages so is this just messages sent or messages received as well?
Robert, hardly. When you only own a mobile (because you have 3G broadband) and you don't want to pay up to £1.20/minute for calls to relatives in the rest of the world, or pay people like Toucan or Alpha or other third-party connection services for voice, text messages come in very handy, especially if you manage to say in four (or more) text messages what would've taken a minute to say over the phone (from a purely voice perspective).
So no, then we're not saddos but rather use a feature on our mobiles that is designed for short messages (after all, it's called Short Messaging Service).
Also, you seem to fail to realise that in the US, consumers pay for incoming messages as well as outgoing ones, so you pay for every MMS, every service message sent by your provider. And when you're in this uniquely Nokia thing called a chat (I think the T-Mobile Sidekick has something similar, and the AT&T iPhone rearranges SMS messages into a chat-like thread), it's easy to lose track how many messages are sent in a conversation.
Since the customer in question is on AT&T, what are the chances that the little one has an iPhone?
Though work pays for the phone and im expected to be on call all the time so yeah im gonna get getting my moneys worth out of the phone.
Though if this was my daughter, REGARDLESS OF HAVING AN UNLIMITED PLAN OR NOT I would slap her silly. Damn she needs help.
/mines the one with the phone in the pocket on silent.
Why is this a story? My 16 year old daughter averages over 20,000 text a month. Our november bill has 23,380 outgoing text and the December bill has 24,060 outgoing text. when we took her phone into Verizon the guy behind the counter said that he had never seen that many text. Even with all this texting she maintains her grades and plays sports. But I'm glad we have unlimited texting because I wouldn't want to have to pay for the text.
I really hate texting. It's so much easier to leave a voice mail msg. I wouldn't have done this in my younger days when I wasted a couple hours a day playing tetris on a desktop, mostly because the keypad is ridiculously small and your just wearing out keys to a phone that cost more than it's really worth. Then again, if the parents are dumb enough to pay for it and not make their kids work for it, I can see why. I think I've managed about a dozen in the past five years.
I suspect that AT&T really won't be too bothered about this volume of texting. A quick check of my phone looks like text messages are just the ASCII character set, and you only get 160 characters per text. So I would have thought that apart from the handshakes to actually send the messages, this is costing them peanuts - 160B per message.
Any thoughts / stats?
Consider 5 girls each OMGing and LOLing eachother through a 4 person list - a scenario that seems more common than just 1:1 texting. Every text sent by each girl == 4 sends and 4 receives. Any one girl will get an average of 4 texts for each one she sends.
That would take it down to only 3000 sends per month - or 100 per day. - or less than 10 per hour.
Amazing they've got so much to say seeing they can only spare three syllables per day for their family.
Not the first spammer, won't be the last.
I figure 20 people in her contact group, message to everyone "waz up" They all return the favor with a reply to all "nuthin you?" even with some auto-reply alls to those reply all's "in da showa" Then 20 idiots frantically trying to delete a crap load of stupid messages. Then repeat this crap every hour or so during breaks etc.
.... correction, they probably don't ever delete old messages. So 200 Gigs of "whatevs" and growing on some poor server somewhere.
Assume the following: (1) that there is AT LEAST one incoming for every outgoing message. (2) that not all incoming are replied to given that they are "annoying forwards". So it's less than 7000 msgs in one month. Given that many of them will also be just "LOL", and other things that can be sent in 3 seconds one-handed, it's not as bad as some people are making out here.
Personally, I find it weird. But I don't own a mobile phone anymore as I found I didn't like being leashed. Lots of people find THAT weird, so who am I to judge?
As a student I previously averaged 1700 per month. I was on BT Genie's "unlimited" texts plan which was brilliant. Especially as a student - why phone when you can text for free?
And then I hit 2300 txts in 1 month and ran into what I discovered was called a "Fair Use" clause - and they capped me at 600.
This was back in 1999/2000.
My girlfriend has the same annoying habit of using texts excessively. She'll often spend half an hour texting every minute or two to sort something that could easily be resolved in thirty seconds if she would PICK UP THE PHONE AND MAKE A CALL WITH IT. You know, like phones are supposed to be used? I can see how you can rack up that amount of texts - it isn't clever, it just shows you don't know how to use your phone effectively.
Personally, I agree with Robert Long - 20 texts a month is plenty.
@ boltar: For the same reason they annoy you with messages via $social_network or $IM instead of sending you a proper e-mail: Because they are morons and do not spend a split second thinking about whether there might be a more clever way of communicating involving less hassle and/or cost. These are the people who even in their late twenties still do not employ a proper e-mail client but only their freakin' webmailer. Some of these people do not even know that there there are such things as e-mail clients. These are the people who, if they bother with e-mail at all, send TOFU HTML, forward "funny" PPTs, and stuff even the smallest bit of text into attached DOCs. In short, the kind that doesn't give a rats ass about anything but their own most imminent desires and in a better world should not be allowed within ten feet of a computer in the first place. These are the people that will make the Palm Pre a boiling success, as they BUG you to no end on ALL platforms and channels available to them EXCEPT e-mail, as honestly e-mail is just too compatible and convenient on the receiving end so you are clearly not devoting enough time to their important inquiry, and the Pre will help you _sort that shit out_. Can't wait!
@ Chris: Because text has a lot of advantages compared to a call, think about it.
Has the world gone mad? Stop it here and let me off.
I think I've sent 4-5 text messages in the 8 years I've had a cell, and they've all been through the online page my provider has. But then again I haven't gone over 30min of talk time in a month on any of my contracts so I'm a big exception. I use a laptop and free wifi to use email, why pay for it on my cell?
As a parent of a US teenager I can't believe any similar parent is unaware of how popular texting is. Most kids would be just as happy with their cell phone if it couldn't make voice calls, as long as the texting was free.
All you do is sign up for an unlimited texting plan. They usually cost between $20-$30 a month (15-20 quid) and include a limited amount of freee voice calling time.
Don't ask me why kids prefer texting over talking, they just do. For example I tried to call my kid one afternoon to find out when he wanted to get picked up, and while 4 calls went unanswered a text message was replied to in seconds.
I don't get it or like it, but it just is. As the text plan is less expensive than the equivalent voice plan I don't see the harm.
I do not have stats, but here is thought : SMS are not using the same data chanel as voice calls; they are using control channel which would normally be used to connect your phone to a BTS, initiate or receive a call etc. This means that the more text messages BTS has to handle, the higher possibility it will fail to connect (someone else's) call - because there simply won't be control channel available at the time.
This post has been deleted by its author
To those who are ranting and raving about how evil texting is. Bear in mind that different people communicate in different ways. Because YOU don't "approve" doesn't make it inherently wrong as last I looked none of you lot were ordained "keeper of universal standards for interpersonal communications" and as such need take your holier than thou attitudes with you whilst taking a long walk off a short pier.
Given that the 14K number is most likely sent and received also given that this is a teen age girl and as such is probably forwarding messages to multiple recipients. Then the number cited is not as excessive as one might think it is. Lets face it the actual number of single recipient texts sent is certainly much lower than the number stated in the headline and therefor wouldn't have been near as sexy and attention grabbing as what equated to "Oh my god look at this text addicted teenager, look at the poor dear. wont someone please think of the children" headline.
So the guy has an unlimited text plan with his carrier and one of his kids used it to it's fullest. Ok, and?? We know that teen's in particular prefer text/IM/e-mail over talking on the phone. This has been shown and reported on time and time again so I fail to see the outrage at this. The kid was doing what kids today do. Being surprised by this is a bit like being surprised that the sun rises in the east and sets in the west. Now personally I'm far from a teen but having spent eight years in a call center doing technical support I have pretty much been put off talking on the phone and do so as little as possible. I'd much rather talk face to face, e-mail, text, or IM. A great many of my friends even those who haven't shared my previous experience on the hell desk are of the same mind, all of us in our mid 30's to early 40's.
A bunch of grownups posting *article comments* on a tech magazine, talking down their noses at teen text users and their frivolous, wasteful dumb antics. Such irony!
And what are we communicating?
Email's better than text; if you send too many texts there's 'something wrong with you'; using webmail in your late 20s is *wrong*.... the list adds up, mostly of people dying to express how superior they feel to people who "should not be allowed within ten feet of a computer in the first place"
Honestly, I invite any contributors to this thread to re-read the bickering, the aloofness and the general autism spectrum behaviour then explain to me why this has more value than some teenager sending 14,000 LOLs.
People communicate at different rates and in different media. Big fucking deal. At least that teenage girl probably has *friends*
Ya just gotta love it.
Just let them kids text away and rationalize their illness. Then parents wonder why their kids have learning, behavioral and social problems that the parent have no clue about... If I have to explain it to you, you wouldn't understand and certainly should not be producing offspring.
Unless you got a huge-arse zillion-minute mobile plan, texting can be 5x or 10x cheaper than calling. Here in Mexico, most mobile users are in the pre-paid plans, where texting is under MXN $1 (that's about $0.08 in USD's); most people will rather send SMS messages than waste airtime.
Even those of us with a "post-pay" plan (that is, with a contract) prefer to use SMS for most things and keep actual voice calls for important stuff.
Oh, the good thing: we don't pay for *incoming* SMS.
Dear AC: So ranting about people stealing your time by imposing their com-prefs on you is autistic? I get that right? Let's get some things straight:
- I live in a place where "unlimited texts" is hard to get, usually you pay through the nose for SMS.
- in the US, you pay for received texts unless you cough up for "unlimited". In my place, SMS are more more expensive, but only the sender pays.
I love to use SMS myself. They allow for time-delayed communication, they can be stored for reference, they are halfway reliable. Nevertheless, if I was in the US I would wonder why the hell I should be forced into an unlimited plan in order to compensate for other peoples' ways of communication. Otherwise, why would I care if some kid wastes its days and thumbs away? Back in the day, teens would clog up the phone-lines, so what? Most of them grew into halfway responsible adults regarding their com-skills. But I see this growth-process being lost. Therefore I see nothing wrong with being annoyed by adults who cannot be arsed to make the slightest effort to think about what they are doing and how their action affects other peoples' time. Further, please do not mangle up my rant. There is nothing wrong with webmail. But if I see people in their late twenties, many of them academics or soon to be, exhibiting the behaviors and lack of education described, it does make me think. Their messy behaviors shape our future communications, with all the bloat and cost and disfunction it brings in its wake. Sue me, but I like stuff to be clean and efficient. If you cannot see how giving a shit or two about your impact on others has some inherent value, I cannot help you.
If you think about it, SMS, IM, and email have the sterling advantage of not preempting ongoing processes like a phone call does. If you phone someone, they have to interrupt what they are doing to service your interrupt, and in the worst case you get the hoary old OS problem of thrashing from insufficient time to context switch.
Indeed, a lot of you all probably IM or text first before calling, to make arrangements to call w/o causing as much disruption (and/or to find out which number to call of the several almost everyone has). Or you would if you if you were a decent human and with the program.
All this talk of texting means great sales for those cell phone repeaters that sell for quite a bit of money, I can imagine the withdrawal symptoms of persons that find themselves in a house that has poor cell reception.... a house with a dusty antediluvian rotary, an old boob, and only a cat to talk to.
I say good for AT&T to allow you to fully utilize your service. If this were comcast, they'd say well even though it's an unlimited plan your going ot be limited to 500 a month. We have to save our text message resources to allow our free text message site that's used by both comcast and non comcast customers to utilize our texting resources, referencing comcasts bandwidth caps and their hosting of fancast.com to anyone in the world.
"Divide that by the average time awake (16hours) equals 14.5625......One text every 14.5625 minutes sent.."
Oops, you means 14.56 texts per hour rather, or one text every 4.12 minutes.
During school time I think this is ridiculous. Perhaps she should be paying more attention to her lessons and less to her phone.....
God some people sound like such old duffers on here.
20 a month, sado! Why not call, why not...why not...
What morons.
Teenage Girl. 20 - 30 friends on a night out.
Txt. running late C U at Cinema at 8
Send to group - 30 friends. Go. Job done.
Or phone 30 people. mm tough call
We use SMS to alert departments of problems with systems. Hitting 50 people at a time (better than email as not everyone spends every waking hour checking mail). Then udate constantly
So even we can send several hundred a month. And we're GROWN ups!
Anyhows, I'm of to get my quill and parchment and state how it will never be replaced by a fountain pen and paper!
To misquote sideshow Bob, "Yes, I am aware of the irony of appearing on television in order to decry it."
Or the irony of posting on a web forum about the irresponsibility of wasting your time on texts.
A 13yo girl has what? 20 friends? And every text is sent to all of them? So even if she sent all 14,000 texts, that's still only 700 in a month, or about 20 per day. That's slightly over one an hour. Texts are only 160B too so she's writing about 400 words per day. Hardly an excessive amount of communication. In my day girls spent hours per day on the phone. The average girl speaks over 10,000 words per day. These girls are communicating less than normal, it seems. Maybe because they have unlimited texts and not unlimited minutes? Hmm, it's almost like they're acting like classical rational consumers, reducing the amount of purchases based on monetary and opportunity cost. And it's almost like their dad is in on the deal, getting them an unlimited texting plan. He's acting like a rational consumer too! The idiot!
The over-reaction on this forum shows that most people lack basic analytic intelligence. Massive props to the AC who said the girl had an "illness". That was the best one.
I hate the telephone. As one comdian put it its like someone coming up to your desk and going "talk to me, talk to me, talk to me, talk to me" until you pay them attention right there and then. At least with a text it can be read in the receivers own time. Of course if you get a reply straight back then it is easier to call them up than continue texting each other (asuming both free calls and texts)
*of course mobiles (and our damn IP phones at work) actaully have this ringtone
I am kinda surprised at some of the replies here. A tech audience who dont seem to get the tech thing going on.
Why would the teens make a (cost) voice call when they can text for free?
If the (pa)rents are paying for the contract, so that little darling is always contactable, then the TCO of texting goes to zero for the teen. Teens always have no money.
Texting beats voice because you can use the handset under the desk during a lesson.
Texting beats voice because you dont have to turn off your iPod to use it.
Texting beats voice because you can show your friends the lame text that boy sent you, because he fancies you.
Texting beats voice because you remain in control of the conversation. Not replying to a text is a lot less rude than hanging up a voice call.
Texting beats voice because you can talk to more than one person at a time.
Did I mention it was free?
I have sent less than 20 texts in my entire life, but my email accounts see the same level of traffic as the little lady texter. Yours too?
The only downside to the texting habit is possible RSI. Is that any worse than sitting at our desks, bashing our keyboards?
Free unlimited internet turned out not to be, when the torrenters got hold of it.
Sometime soon, someone will figure out how to VPN a torrent over the text messaging service, and that will drown too.
<quote>Why is this a story? My 16 year old daughter averages over 20,000 text a month. Our november bill has 23,380 outgoing text and the December bill has 24,060 outgoing text. when we took her phone into Verizon the guy behind the counter said that he had never seen that many text. Even with all this texting she maintains her grades and plays sports. But I'm glad we have unlimited texting because I wouldn't want to have to pay for the text.</quote>
Rough estimate, it's 1 text sent a minute (8 hours weekdays/16hours weekends), she's 16? so she's at school? unless she's sending the same text to her entire phonebook she has a problem, by the sound of it she's not engaging with you at home, so you have communication issues, what else isn't she telling you? are you sure she's getting good grades? you say "WE have unlimited texting" so she doesn't pay the bill anyway? No financial responsibility and doesn't communicate with you? does she drink, do drugs? would you know? fostering a compulsive character like this is very dangerous (and at 16 it's probably too late to do anything about it), you seem to think that sending 20,000 texts is OK for no other reason than your daughter does it, therefore there can't be a problem, rather than accepting the fact that sending 20,000 texts a month might actually point to a problem.
FACT: Your daugter is sending an abnormal amount of texts, there is a reason for this, either she is "special" or she has a problem (you'd say "special", 99.9% of the population may think otherwise)
Yeah, from a phone booth, using some Atari portable and acoustic coupler *g* Too bad there hardly are phone booths anymore... in Germany, the few that remain are slowly replaced with "telepoles" that only have one pane and a joke of a roof. Heaven forbid you be in private or at least dry...
So when does she actually SEE her friends or TALK to her friends? If she's constantly "TxTiNg lol rofl" or whatever the cretins call it nowadays, when does she actually physically interact?!
And do such people realise it's quicker to phone someone and say "Do you want to come to the pub? Yes? See you there in half an hour!" than to have 10 texts back and forth?
Textards? No? Or is that too long to write in an SMS?
I'm bewildered by the viewpoint I seem to see a lot on here that people who text/use Facebook etc never see anyone in real life. If you're doing it right then it facilitates the seeing of your dear chums in the actual real life.
Also, the baffling FEAR and RAGE that seems to bubble beneath. Can't anyone just be mildly irritated any more?
.. they are in teh US, where unlimited actually is unlimitted, unlike here in teh uk where unlimited means a unspecified limit.
Oh and "Free unlimited internet turned out not to be, when the torrenters got hold of it." <-- why is it he fault of people that use the provided bandwidth, its the fault of the isp for overselling and selling bandwidth they don't have!
Ja no - this is quite the interesting debate.
Let's face it: communication has "evolved", due to the accessibility of electronic mediums, to a point where teenagers no longer rely on voice-based communication. I remember when I was 16 and would phone my (first!) girlfriend every day to chat for fifteen minutes. It was a landline-to-landline call. We didn't have cellphones, but we both had email accounts. I had an early Yahoo! mail account at the time, but I was only able to check that when dad dialled up to the Internet (think NCSA Mosaic and WinSock).
Nowadays I spend a LOT of time out with friends. When I organise a movie night at my house, or dinner at Sevruga, or drinks at Barazza, I invite 50-60 people. Not all those people are on email (or access it regularly). Fewer still are on Facebook, or are active in checking their Facebook accounts. A handful are on Twitter. Yet if I send an sms to all of them it takes me a few seconds (groups on my iPhone rock), and I'm guaranteed to get the 10 or 20 people I want there. This is MUCH MUCH faster than phoning 60 people. It's also MUCH MUCH more impersonal, and that is why many of those invite messages go unanswered. I don't get offended if people don't reply, their lack of reply is an indication that they are busy and will probably not be able to make it.
There is a distinct time dilation advantage to text messages, that has been alluded to already. If one of those people that I invite has a serious boyfriend or girlfriend, or is married, they may need to check with their partner before accepting. So the cost of 1 sms from me, plus 1 sms in response from them once they have checked with their significant other, is inconsequential when compared to the cost of me phoning and putting them on the spot, having to hear them stutter whilst they try check their diary, and then them phoning me back later once they have their thoughts organised and are more consciously aware of what is going on in their lives.
I arrange between one and three social gatherings a week. I send around 700 sms's a month. I do not spend an excessive amount of time sending those, because the vast majority of them are group sms invites, or bulk sms directions, and the like. Text messaging has its place, and is rapidly becoming the way that young people choose to communicate. In fact, the impersonal nature of it may be PART of the appeal to them. If you're a teenager sending text messages, It's easier to deal with issues, it's easier to ask someone out, it's easier to tell someone a secret. Personally, the fact that a possibly-permanent record of a message lives on somebody else's phone always tempers the content of the messages I send, but that's because I PREFER hearing the tonal inflection in someone's voice when I'm having a REAL conversation with them..
The world is a-changing. As experts, hobbyists, or merely those vaguely interested in technology, we either shift our expectations along with it or we get left in the dust.
"Hmm, it's almost like they're acting like classical rational consumers, reducing the amount of purchases based on monetary and opportunity cost."
I'll be sure to get the best deal on my assault rifle and large tin of Freakonomics kool-aid before I shoot up the nearest school, then.
I normally enjoy the articles on the reg (especially the BOFH) lately though some of the comments are really starting to wind me up. So many self important gimps are commenting who are under the impression that unless you have several degrees and qualifications involving IT support/computer science/programming/and general it knowledge then you should locked up in a room away from anything technical.
Just because you do not have an inherent understanding of the way something works (for instance fair usage policy on texts, one comment on here relates in quite a condescending way to which channel on a mobile network a text uses) does not make it somehow the norm for you not to stopped from using a PC. The majority of PC users have no interest in the inner workings of a pc, they simply wanna surf the net or store photos and videos etc etc. So what if this girl has over 14K texts on her monthly bill, she's a teenager what else do her parents expect. Its unlimited it aint gonna cost them.
For gods sake stop shooting everyone down, just because not everyone has the same astounding knowledge of technology as you does not make them a complete retard.
For the record im a hobbyist when it comes to tech and pc's
Paris cos she takes everyone on they're merits (but only 2 people though)
"How quaint. The point of it being what exactly? Some tosser sends me an unsolicited message and I pay for the privilege? That's f***ed."
To explain the point I will use the UK's alternative system to show the flaw in the alternative.
In the UK you might have an "Orange" phone. When you send a text message to an "o2" phone, Orange have to do two things. First they must get the message to o2, second they must pay o2 to deliver the message to the recipient.
The price Orange must pay o2 is decided by o2, and even though it only costs them part of a penny they actually charge noticeably more than that. Because of this, providers need to charge customers more than they are being charged to avoid losing money, and they can't force the price down because refusing to pay the charge would mean that your Orange phone didn't work for sending messages to o2 (which looks like a flaw with your phone to customers).
The US system works much more transparently. When I choose a provider they are completely in control of how much they charge me for connecting calls and carrying messages. This means that I as a consumer am able to give my trade to the most competitive supplier. This is why in the US unlimited phone call and text packages are so cheap and much closer to 'genuinely unlimited' than the UK equivalents.
When you buy an unlimited text package from Orange they have to pay a couple of pennies every time you send to another network, so you can bet the 'unlimited' figure is probably doesn't let you cost them more than they pay.
- - -
All of the above said I would prefer the American system with one change, Suppliers should give people the ability to maintain a whitelist of numbers. If someone who is not on this whitelist texts them they should be able to charge a fee (perhaps as little as $0.002) to receive the message.
Done correctly this charge would make SMS spam extremely expensive.
...Was she using any sort of QWERTY cell phone or the regular number-only cell? My crusty old motorola takes forever to type any letters using the 0-9 keypad (plus it does not guess the whole word thingy).
If it is not QWERTY, and if she changed her cell to one, how many txts would she be able to spam in a day?
Assuming each 0-9 key holds 4 letters tops, and on a fair rate she would be typing 3X faster...
...you do the math, all of you seem to love calculating "what-ifs"...
Paris, because I'd love to txt her and 20 girls she knows "party tonite, my place"
When does the point come when we are *too* connected? Is it really healthy to be able to talk to anyone at any time without taking time for reflection?
I don't see a problem using any tool such as email or texting or phones when necessary, sometimes it's simply easier or more convenient for either party to send a text instead of calling or actually going to see your recipient. However when you become dependant on a tool for day to day life you start to wonder what you are losing... It's good to evolve, but evolving doesn't mean completely throwing away old ways, it means adapting them to current needs.
The Register 
Biting the hand that feeds IT
Copyright. All rights reserved © 1998–2024
